ID: 1139619255_1139619261

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1139619255 1139619261
Species Human (GRCh38) Human (GRCh38)
Location 16:68123867-68123889 16:68123889-68123911
Sequence CCCAGGTACTAGGGAGGCTGAGG GCGGGAGCATTGCCTGAGATGGG
Strand - +
Off-target summary {0: 101, 1: 10974, 2: 220692, 3: 282545, 4: 181490} {0: 1, 1: 0, 2: 7, 3: 195, 4: 2596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!