ID: 1139698404_1139698420

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1139698404 1139698420
Species Human (GRCh38) Human (GRCh38)
Location 16:68691940-68691962 16:68691993-68692015
Sequence CCCCACCCCCTCCCTGAGGATGG CTTTAACTCCTGGAACTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 489} {0: 1, 1: 0, 2: 0, 3: 18, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!