ID: 1139743299_1139743304

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1139743299 1139743304
Species Human (GRCh38) Human (GRCh38)
Location 16:69054109-69054131 16:69054133-69054155
Sequence CCTGGCTGGAGGGTTCCGGAAGA GAGTGGAAAGAGAAGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 157} {0: 1, 1: 0, 2: 6, 3: 107, 4: 995}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!