ID: 1139752965_1139752969

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1139752965 1139752969
Species Human (GRCh38) Human (GRCh38)
Location 16:69120284-69120306 16:69120301-69120323
Sequence CCGAGTTCACACCCAGTGGGTGG GGGTGGCCTGTGTTCAGAACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 134} {0: 2, 1: 0, 2: 0, 3: 33, 4: 1210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!