ID: 1139759880_1139759889

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1139759880 1139759889
Species Human (GRCh38) Human (GRCh38)
Location 16:69176317-69176339 16:69176358-69176380
Sequence CCTGTGTTTCCTAGCTACTCGAG TGCTTGAGCCTGGGAGGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 237} {0: 655, 1: 3014, 2: 17397, 3: 57273, 4: 114126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!