ID: 1139775083_1139775101

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1139775083 1139775101
Species Human (GRCh38) Human (GRCh38)
Location 16:69311723-69311745 16:69311767-69311789
Sequence CCTCAGGCCTTCCGGCCCTGCCC GCTTCGTGTAGCCGGCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 505} {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!