ID: 1139785011_1139785018

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1139785011 1139785018
Species Human (GRCh38) Human (GRCh38)
Location 16:69385746-69385768 16:69385764-69385786
Sequence CCGGCTCGTGGCGCCCCCGCCGG GCCGGGCCCGCCCGCTACTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157} {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-5 16:69385746-69385768 CCGGCTCGTGGCGCCCCCGCCGG - 16:69385764-69385786 GCCGGGCCCGCCCGCTACTGCGG +