ID: 1139824313_1139824325

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1139824313 1139824325
Species Human (GRCh38) Human (GRCh38)
Location 16:69745157-69745179 16:69745207-69745229
Sequence CCACTGAAGCTGTCAGCAAAGGG AACCACAGGAGGGGCAGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 205} {0: 1, 1: 0, 2: 0, 3: 24, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!