ID: 1139848822_1139848829

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1139848822 1139848829
Species Human (GRCh38) Human (GRCh38)
Location 16:69938703-69938725 16:69938749-69938771
Sequence CCAAAAACCTTATACCCATTAAG CTCTAAAAGCAGAACGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 202} {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!