ID: 1139851002_1139851021

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1139851002 1139851021
Species Human (GRCh38) Human (GRCh38)
Location 16:69951620-69951642 16:69951670-69951692
Sequence CCCTGGGACAGCCCGGGGGCGGT AGGAGGAGGAAGGAGGACCAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 11, 4: 135} {0: 3, 1: 1, 2: 37, 3: 317, 4: 1725}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!