ID: 1139951386_1139951390

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139951386 1139951390
Species Human (GRCh38) Human (GRCh38)
Location 16:70673313-70673335 16:70673361-70673383
Sequence CCCAGAGAGAGACTCAGATTCCT GCTGACCTTCCAACCAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 958} {0: 1, 1: 0, 2: 0, 3: 10, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!