ID: 1139955639_1139955649

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1139955639 1139955649
Species Human (GRCh38) Human (GRCh38)
Location 16:70691765-70691787 16:70691782-70691804
Sequence CCCCACACTCAGCCATCCGAGGG CGAGGGCCAGTCTGGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 141} {0: 1, 1: 0, 2: 0, 3: 40, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!