ID: 1139956585_1139956589

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1139956585 1139956589
Species Human (GRCh38) Human (GRCh38)
Location 16:70696160-70696182 16:70696173-70696195
Sequence CCAATCCTGGGTTACATGTCAGG ACATGTCAGGCACCCATGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111} {0: 1, 1: 0, 2: 0, 3: 19, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!