ID: 1139962223_1139962230

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1139962223 1139962230
Species Human (GRCh38) Human (GRCh38)
Location 16:70724570-70724592 16:70724597-70724619
Sequence CCTGCCATTCCCATTGCGAAGGG CTAATTAGGAGATGAGAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 89} {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!