ID: 1139967921_1139967933

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1139967921 1139967933
Species Human (GRCh38) Human (GRCh38)
Location 16:70755879-70755901 16:70755922-70755944
Sequence CCAGCCACCTGGGAACCTAGGGG TTCCTCACAGCACAGCTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 246} {0: 1, 1: 0, 2: 1, 3: 26, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!