ID: 1139987877_1139987884

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1139987877 1139987884
Species Human (GRCh38) Human (GRCh38)
Location 16:70915639-70915661 16:70915666-70915688
Sequence CCAGAGACCATCAGCTGTGGTAA GAGAGGAAGGAACCAGTGGTGGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 102, 3: 156, 4: 265} {0: 2, 1: 0, 2: 0, 3: 40, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!