ID: 1139991191_1139991197

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139991191 1139991197
Species Human (GRCh38) Human (GRCh38)
Location 16:70940783-70940805 16:70940831-70940853
Sequence CCTTAATTGGAAAAGCATTATGA GCGGTAAGCCGGAGTGAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 27, 4: 216} {0: 2, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!