ID: 1140018598_1140018601

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1140018598 1140018601
Species Human (GRCh38) Human (GRCh38)
Location 16:71214583-71214605 16:71214611-71214633
Sequence CCTTGGTTTATCTGACAGGAACC GTGCTCACACATATGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121} {0: 1, 1: 0, 2: 2, 3: 5, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!