ID: 1140124324_1140124334

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1140124324 1140124334
Species Human (GRCh38) Human (GRCh38)
Location 16:72107414-72107436 16:72107466-72107488
Sequence CCAACGTGGTGCTGCTGCTCAAG CCACTTCATGGACCCGCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 143} {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!