ID: 1140126112_1140126121

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1140126112 1140126121
Species Human (GRCh38) Human (GRCh38)
Location 16:72120257-72120279 16:72120281-72120303
Sequence CCTGTGAAAGAAGCCCAGGCCTG GGTCTGAGTGGACCAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 219} {0: 1, 1: 0, 2: 1, 3: 32, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!