ID: 1140131577_1140131586

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1140131577 1140131586
Species Human (GRCh38) Human (GRCh38)
Location 16:72166571-72166593 16:72166593-72166615
Sequence CCAAGAAAAACCAGCATGGAAGA AGGGGGAAGCAGGACAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 293} {0: 1, 1: 1, 2: 22, 3: 196, 4: 1432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!