ID: 1140189757_1140189761

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1140189757 1140189761
Species Human (GRCh38) Human (GRCh38)
Location 16:72805338-72805360 16:72805374-72805396
Sequence CCTACCGCCTTGGCATTGCTCAC TCTGAAAAGCCCACTATTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128} {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!