ID: 1140213329_1140213332

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1140213329 1140213332
Species Human (GRCh38) Human (GRCh38)
Location 16:72987827-72987849 16:72987841-72987863
Sequence CCCTAGGACTGCCTTTCATGAAT TTCATGAATCACCTGCTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144} {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!