ID: 1140407653_1140407664

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1140407653 1140407664
Species Human (GRCh38) Human (GRCh38)
Location 16:74721727-74721749 16:74721754-74721776
Sequence CCACCCAGCTTCCTACTTCACAG GAGAGGCCCTGGGGTTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 284} {0: 1, 1: 0, 2: 8, 3: 127, 4: 953}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!