ID: 1140408992_1140409012

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1140408992 1140409012
Species Human (GRCh38) Human (GRCh38)
Location 16:74730111-74730133 16:74730160-74730182
Sequence CCCCCAGCTGCTCTGGAGGTGGA AGCAGGGGGGTGGGGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 492} {0: 1, 1: 0, 2: 3, 3: 60, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!