ID: 1140410530_1140410536

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1140410530 1140410536
Species Human (GRCh38) Human (GRCh38)
Location 16:74738150-74738172 16:74738165-74738187
Sequence CCAGCCCTCGCCCTTCCGTCTCA CCGTCTCAGCCCAGAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 281} {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!