ID: 1140462848_1140462852

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1140462848 1140462852
Species Human (GRCh38) Human (GRCh38)
Location 16:75154951-75154973 16:75154968-75154990
Sequence CCATAGCCCAGCTAATTTTTGTA TTTGTATTTTTAGTAGAGATGGG
Strand - +
Off-target summary {0: 2, 1: 53, 2: 740, 3: 1420, 4: 2402} {0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!