ID: 1140480302_1140480305

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1140480302 1140480305
Species Human (GRCh38) Human (GRCh38)
Location 16:75258859-75258881 16:75258878-75258900
Sequence CCAGCGCTGGGGCAGGCGCAGCA AGCAAGGAGTGTCTGCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 313} {0: 1, 1: 0, 2: 4, 3: 27, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!