ID: 1140504817_1140504828

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1140504817 1140504828
Species Human (GRCh38) Human (GRCh38)
Location 16:75464587-75464609 16:75464638-75464660
Sequence CCCTCGCGCTCCATCCCGTCGCC GCCCGAAGTGCGGTAGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98} {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!