ID: 1140514728_1140514732

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1140514728 1140514732
Species Human (GRCh38) Human (GRCh38)
Location 16:75533683-75533705 16:75533712-75533734
Sequence CCAAAATGCAATTCTTGACTGCC CTGTGTAAAAGGAGAGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 375} {0: 1, 1: 2, 2: 3, 3: 76, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!