ID: 1140533180_1140533186

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1140533180 1140533186
Species Human (GRCh38) Human (GRCh38)
Location 16:75684328-75684350 16:75684364-75684386
Sequence CCCTGCGTTCAGGGTTTTGGAAA GTGGAGGGAAGGTGTTTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 135} {0: 1, 1: 0, 2: 2, 3: 19, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!