ID: 1140724236_1140724244

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1140724236 1140724244
Species Human (GRCh38) Human (GRCh38)
Location 16:77797724-77797746 16:77797763-77797785
Sequence CCGATGACCTCCAAGCTCCTGGG AGAGAGCCTTTTGGACATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 259} {0: 1, 1: 0, 2: 0, 3: 24, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!