ID: 1140732451_1140732456

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1140732451 1140732456
Species Human (GRCh38) Human (GRCh38)
Location 16:77869113-77869135 16:77869126-77869148
Sequence CCAAAATCAGGAGAATGAGTAGC AATGAGTAGCAGAAGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 162} {0: 1, 1: 0, 2: 4, 3: 48, 4: 555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!