ID: 1140842797_1140842801

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1140842797 1140842801
Species Human (GRCh38) Human (GRCh38)
Location 16:78856516-78856538 16:78856529-78856551
Sequence CCCTGTAATAGCAGCTACTCAGG GCTACTCAGGAGTCTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 931, 3: 2404, 4: 3989} {0: 819, 1: 83375, 2: 182235, 3: 213216, 4: 143590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!