ID: 1141045871_1141045878

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1141045871 1141045878
Species Human (GRCh38) Human (GRCh38)
Location 16:80715771-80715793 16:80715800-80715822
Sequence CCATCTCCTCCTCACTCTCTGCC CCACTCTATGGAATCATCCATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 26, 3: 341, 4: 3037} {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!