ID: 1141108627_1141108628

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1141108627 1141108628
Species Human (GRCh38) Human (GRCh38)
Location 16:81253934-81253956 16:81253947-81253969
Sequence CCTGGTGACAGCAAGACCCTGTC AGACCCTGTCTCACAAAGAAAGG
Strand - +
Off-target summary {0: 3, 1: 13, 2: 66, 3: 174, 4: 464} {0: 1, 1: 21, 2: 214, 3: 706, 4: 1341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!