ID: 1141151102_1141151108

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1141151102 1141151108
Species Human (GRCh38) Human (GRCh38)
Location 16:81565245-81565267 16:81565261-81565283
Sequence CCATGGCCCACCTTCCAAAGGAA AAAGGAAGATTTGCCCCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242} {0: 1, 1: 0, 2: 1, 3: 17, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!