ID: 1141171406_1141171418

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1141171406 1141171418
Species Human (GRCh38) Human (GRCh38)
Location 16:81693954-81693976 16:81693983-81694005
Sequence CCTTCCACCTTCTGCCCCTGAGC ACATGGGCAGGGACCTAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 573} {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!