ID: 1141367263_1141367272

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1141367263 1141367272
Species Human (GRCh38) Human (GRCh38)
Location 16:83455326-83455348 16:83455378-83455400
Sequence CCAATGACAGCTGTTTCTGAGCA CTGGCCCACCTGAGGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 201} {0: 1, 1: 2, 2: 3, 3: 39, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!