ID: 1141438721_1141438723

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141438721 1141438723
Species Human (GRCh38) Human (GRCh38)
Location 16:84015645-84015667 16:84015676-84015698
Sequence CCATCAGGAGCTGTATTAGTCTG CTGCTAATAAAGACCTACCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 214} {0: 1, 1: 2, 2: 85, 3: 158, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!