ID: 1141439997_1141440007

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1141439997 1141440007
Species Human (GRCh38) Human (GRCh38)
Location 16:84024091-84024113 16:84024124-84024146
Sequence CCAGTAACAGCCCCCCTCCCCCA ACCCAAAATGTCTGCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 62, 4: 468} {0: 1, 1: 6, 2: 36, 3: 79, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!