ID: 1141448529_1141448533

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1141448529 1141448533
Species Human (GRCh38) Human (GRCh38)
Location 16:84080506-84080528 16:84080546-84080568
Sequence CCAGCAGCTCAGGTCTCCTCTGC CACCCGCAGCTGCCACCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 366} {0: 1, 1: 1, 2: 6, 3: 31, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!