ID: 1141454510_1141454516

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1141454510 1141454516
Species Human (GRCh38) Human (GRCh38)
Location 16:84131285-84131307 16:84131318-84131340
Sequence CCCTGTACAAGAGGTAGAAACTG CCATGGCAACCTGCAGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 248} {0: 1, 1: 0, 2: 1, 3: 40, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!