ID: 1141470643_1141470653

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1141470643 1141470653
Species Human (GRCh38) Human (GRCh38)
Location 16:84236152-84236174 16:84236199-84236221
Sequence CCTTACTGTGGAGCTCCGAGGAA CCTCATCTGAAAATGGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 76} {0: 1, 1: 0, 2: 1, 3: 25, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!