ID: 1141486446_1141486455

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1141486446 1141486455
Species Human (GRCh38) Human (GRCh38)
Location 16:84343351-84343373 16:84343397-84343419
Sequence CCATCACGCTGGGCCCGGGGTCC CCTCCTTGGCTACAGCTGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169} {0: 1, 1: 3, 2: 6, 3: 26, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!