ID: 1141500147_1141500149

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1141500147 1141500149
Species Human (GRCh38) Human (GRCh38)
Location 16:84438488-84438510 16:84438507-84438529
Sequence CCAGTCTCATTTCCAAGAGAGCA AGCATCTCACCAGCTCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218} {0: 1, 1: 0, 2: 1, 3: 19, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!