ID: 1141501473_1141501489

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1141501473 1141501489
Species Human (GRCh38) Human (GRCh38)
Location 16:84447416-84447438 16:84447453-84447475
Sequence CCTTCTTCCCTCCCTCCCCACCA ATTCTATTTTAAGTCTGGGATGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 56, 3: 735, 4: 6846} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!