ID: 1141506561_1141506571

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1141506561 1141506571
Species Human (GRCh38) Human (GRCh38)
Location 16:84482103-84482125 16:84482132-84482154
Sequence CCCGCTTCCCCCTGCTTCCTGTG CACCAAGCTGAAGCGAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 55, 4: 633} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!