ID: 1141585366_1141585376

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1141585366 1141585376
Species Human (GRCh38) Human (GRCh38)
Location 16:85029972-85029994 16:85030006-85030028
Sequence CCGTCTGACGCTGGATATAGCAG CTGTGGAATGGGAAGTGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 2, 1: 0, 2: 3, 3: 63, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!