ID: 1141592313_1141592323

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141592313 1141592323
Species Human (GRCh38) Human (GRCh38)
Location 16:85077193-85077215 16:85077224-85077246
Sequence CCTAGTGGCTTCTCAGTGCACAG GGGGGCACTCACGGGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 422} {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!